Real-time qPCR/PCR

A qPCR workflow involves multiple steps, each of which adds to the time and cost of the entire experiment. The PrimePCR™ Assays and Panels from Bio-Rad eliminate a number of these steps with their predesigned primers and probes and help with the assay design. See what steps they eliminate and how that would help expedite your qPCR experiment.

Traditional real-time PCR workflows often limit the number of genes that can be studied, especially when sample amounts are small. A new workflow now allows Mark Kibschull of the Lunenfeld-Tanenbaum Research Institute in Toronto to track the expression of hundreds of genes using a fraction of the starting material required by traditional methods.

Conducting a triplex one-step RT-qPCR assay promises a more efficient and economical analysis of gene expression compared to running three individual assays. This technical report describes a colorectal cancer case study where a triplex multiplex assay was validated.

Bio-Rad’s Universal Real-Time PCR Kits and Reagents work on all real-time PCR systems. Now you can easily compare performance data and get supporting documents for these kits and reagents using Bio-Rad’s new tablet and web app. Learn more and download the app here.

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity

Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.

Obtaining accurate quantitative PCR data depends on choosing and validating the proper reagents for a given experiment. These new tutorials present the knowledge base needed to understand the parameters involved in reagent selection in order to get the best results from real-time PCR procedures.

PrimePCR™ assays for real-time PCR and Droplet Digital™ PCR are expertly designed and experimentally validated for guaranteed performance. Ways to order PrimePCR assays: My PrimePCR Reorder previously ordered assays PrimePCR Product Page Search for a gene, disease, or pathway name Unique Assay ID Search for the ID found on the spec sheet  

Dr. Tim Inglis of the University of Western Australia seeks better ways to conduct surveillance and respond to outbreaks of tropical infectious diseases. For over a decade he’s been developing detection assays for a slate of pathogens. Find out how Bio-Rad’s MiniOpticon Real-Time PCR system allows him to effectively run these assays in such remote locations as the Kimberley Wilderness in Australia’s Top End.

Bio-Rad introduces new Hard-Shell 96-well Semi-skirted low profile PCR plates for optimal performance with a variety of real-time PCR systems.