ArticlesElectrophoresis/Western BlottingFeatured StoriesProduct HighlightsProtocols and TipsReal-time qPCR/PCR

A Superior Method for Parallel Analysis of RNA and Protein Expression from Cell Culture Lysates

It is imperative to analyze both the transcriptional and translational profiles for a complete understanding of the functioning of genes. Here we describe a simple protocol that enables parallel analysis of both RNA and protein from single cell culture lysates. See how this workflow could save time and money and yield more reliable data than the traditional protocols used.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

The Importance of Quality PCR Plastics

Do we ever think seriously about PCR plates, seals, and tubes as contributing to the quality of our gene expression results? Chances are that these PCR plastics are viewed just as labware by most people. In this article we bring out how simple factors, such as PCR plate rigidity, color of the wells, and adhesiveness of plate seals, can affect your gene expression results and show why it is important to use quality PCR plastics.
READ MORE →
ArticlesCustomer StoriesFeatured StoriesReal-time qPCR/PCR

Using PrimePCR™ Gene Expression Assays to Understand Breast Cancer Metastasis

Tumor metastasis is a complex process. It requires the ability of the cancer cells to invade their surroundings and travel to distant sites and survive. Dr. Traci Lyons studies the mechanism of COX-2 functioning in the metastasis of breast cancer cells. Find out how Dr. Lyons used Bio-Rad’s PrimePCR™ Assays to confirm COX-2 knockdown at the mRNA level.
READ MORE →
ArticlesFeatured StoriesProduct HighlightsReal-time qPCR/PCR

New Product Feature: gDNA-Free cDNA in Two Simple Steps

Removing genomic DNA contamination from cDNA preparations is a challenge. All currently available methods are time consuming, could lead to sample loss, and are not efficient. Bio-Rad’s iScript™gDNA Clear cDNA Synthesis Kit tackles these issues and makes this step effortless. This article presents the performance data of the kit and describes how simple and efficient it is to use the kit for gDNA removal.
READ MORE →
ArticlesReal-time qPCR/PCRResearch Highlights

So, How Can the Sso7d Fusion Polymerase Technology Help Your PCR?

During a PCR reaction, it is imperative for the DNA polymerase to remain attached to the template while extending the new strand. This association is jeopardized under challenging PCR conditions and when amplifying longer DNA fragments. See how Sso7d, a small protein capable of binding with the polymerase, helps in stabilizing this association and increasing PCR efficiency.
READ MORE →
ArticlesFeatured StoriesProduct HighlightsReal-time qPCR/PCR

Bio-Rad’s PrimePCR™ Assays and Panels Eliminate Multiple Steps from Your qPCR Workflow

A qPCR workflow involves multiple steps, each of which adds to the time and cost of the entire experiment. The PrimePCR™ Assays and Panels from Bio-Rad eliminate a number of these steps with their predesigned primers and probes and help with the assay design. See what steps they eliminate and how that would help expedite your qPCR experiment.
READ MORE →
ArticlesCustomer StoriesFeatured StoriesReal-time qPCR/PCR

Too Many Questions, Too Little Sample: Developing a Real-Time PCR Workflow for Monitoring Gene Expression in Limited Samples

Traditional real-time PCR workflows often limit the number of genes that can be studied, especially when sample amounts are small. A new workflow now allows Mark Kibschull of the Lunenfeld-Tanenbaum Research Institute in Toronto to track the expression of hundreds of genes using a fraction of the starting material required by traditional methods.
READ MORE →
ArticlesReal-time qPCR/PCRTechnical Reports

Better, Faster, and Less Expensive Gene Expression Analysis Using Multiplex One-Step RT-qPCR: A Case Study of Colorectal Cancer

Conducting a triplex one-step RT-qPCR assay promises a more efficient and economical analysis of gene expression compared to running three individual assays. This technical report describes a colorectal cancer case study where a triplex multiplex assay was validated.
READ MORE →
AppsArticlesProduct HighlightsReal-time qPCR/PCR

Bio-Rad’s Universal Real-Time PCR App – Everything You Need to Know about Real-Time PCR at Your Fingertips

Bio-Rad’s Universal Real-Time PCR Kits and Reagents work on all real-time PCR systems. Now you can easily compare performance data and get supporting documents for these kits and reagents using Bio-Rad’s new tablet and web app. Learn more and download the app here.
READ MORE →
Real-time qPCR/PCR

PrimePCR ddPCR CNV Assay Validation Data

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity
READ MORE →