Using PrimePCR™ Gene Expression Assays to Understand Breast Cancer Metastasis
Tumor metastasis is a complex process. It requires the ability of the cancer cells to invade their surroundings and travel to distant sites and survive. Dr. Traci Lyons studies the mechanism of COX-2 functioning in the metastasis of breast cancer cells. Find out how Dr. Lyons used Bio-Rad’s PrimePCR™ Assays to confirm COX-2 knockdown at the mRNA level.
New Product Feature: gDNA-Free cDNA in Two Simple Steps
Removing genomic DNA contamination from cDNA preparations is a challenge. All currently available methods are time consuming, could lead to sample loss, and are not efficient. Bio-Rad’s iScript™gDNA Clear cDNA Synthesis Kit tackles these issues and makes this step effortless. This article presents the performance data of the kit and describes how simple and efficient it is to use the kit for gDNA removal.
So, How Can the Sso7d Fusion Polymerase Technology Help Your PCR?
During a PCR reaction, it is imperative for the DNA polymerase to remain attached to the template while extending the new strand. This association is jeopardized under challenging PCR conditions and when amplifying longer DNA fragments. See how Sso7d, a small protein capable of binding with the polymerase, helps in stabilizing this association and increasing PCR efficiency.
Bio-Rad’s PrimePCR™ Assays and Panels Eliminate Multiple Steps from Your qPCR Workflow
A qPCR workflow involves multiple steps, each of which adds to the time and cost of the entire experiment. The PrimePCR™ Assays and Panels from Bio-Rad eliminate a number of these steps with their predesigned primers and probes and help with the assay design. See what steps they eliminate and how that would help expedite your qPCR experiment.
Too Many Questions, Too Little Sample: Developing a Real-Time PCR Workflow for Monitoring Gene Expression in Limited Samples
Traditional real-time PCR workflows often limit the number of genes that can be studied, especially when sample amounts are small. A new workflow now allows Mark Kibschull of the Lunenfeld-Tanenbaum Research Institute in Toronto to track the expression of hundreds of genes using a fraction of the starting material required by traditional methods.
Better, Faster, and Less Expensive Gene Expression Analysis Using Multiplex One-Step RT-qPCR: A Case Study of Colorectal Cancer
Conducting a triplex one-step RT-qPCR assay promises a more efficient and economical analysis of gene expression compared to running three individual assays. This technical report describes a colorectal cancer case study where a triplex multiplex assay was validated.
Bio-Rad’s Universal Real-Time PCR App – Everything You Need to Know about Real-Time PCR at Your Fingertips
Bio-Rad’s Universal Real-Time PCR Kits and Reagents work on all real-time PCR systems. Now you can easily compare performance data and get supporting documents for these kits and reagents using Bio-Rad’s new tablet and web app. Learn more and download the app here.
PrimePCR ddPCR CNV Assay Validation Data
Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity
New PrimePCR™ Probe Assays for Real-time PCR and Droplet Digital™ PCR Technologies
Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.
Real-Time PCR Interactive Tutorials — From Reagent Selection to Real-Time PCR Data Analysis
Obtaining accurate quantitative PCR data depends on choosing and validating the proper reagents for a given experiment. These new tutorials present the knowledge base needed to understand the parameters involved in reagent selection in order to get the best results from real-time PCR procedures.