Posts

Prof. Alec Morley, a pioneer in digital PCR, describes his use of Droplet Digital PCR (ddPCR™) technology to advance the diagnosis and treatment of leukemia. Morley and his colleagues at Flinders University and Medical Center in Adelaide, South Australia previously developed a digital PCR method for the early detection of residual acute lymphoblastic leukemia (ALL). Learn how Morley is now using Bio-Rad’s ddPCR technology to develop a diagnostic test for monitoring chronic myeloid leukemia.

In the early 1990s, researcher Alec Morley and his colleagues pioneered digital PCR techniques to measure acute lymphoblastic leukemia. Today, Morley is trying to develop a more accurate way to quantify chronic myeloid leukemia. Find out why he chose Bio-Rad’s Droplet Digital PCR technology for this effort.

Meet Janna and Tomas. After hearing competing claims about the scalability of next-generation chromatography systems, this dynamic duo took it upon themselves to discover the truth. Now let’s face it, when you think of protein purification you don’t usually think of good times. But somehow Janna and Tomas manage to keep the mood light even as they put the systems to the test by simulating changing protein purification needs. Their conclusion? Vote Yes for Better Chromatography. Vote Yes for Bio-Rad.

What does it take to configure your own chromatography system? Part three of The Chromatography Chronicles examines how the NGC™ chromatography system adapts and grows to meet changing lab needs, and the modular design that makes this possible.

A day in the life of Maria, a post-graduate scientist. Both Maria and her PI are annoyed with their unreliable, out-dated protein purification system, and her PI asks Maria to buy them a new one. She struggles to find a system that meets all their needs until she remembers that Bio-Rad has a new next-generation chromatography system that will work for everyone!

Good data processing practice ensures that protein interaction experiments using a surface plasmon resonance (SPR) system will yield the clearest possible results. Here we present tips for understanding and processing SPR sensorgrams when using Bio-Rad’s ProteOn™ XPR36 protein interaction array system.

Is spending hours in the coldroom just an inevitable part of doing chromatography? The engineers and designers at Bio-Rad believed that, with a little innovation, the answer could be “no.” Part two of The Chromatography Chronicles reveals how they freed the NGC™ medium-pressure chromatography system — and its users — from the coldroom’s chilly confines.

Evaluating potential protein therapies for purity and/or identity represents a vital and highly regulated step in biological drug development. Bio-Rad’s new Biologics Analysis Workflow™ offers a high-throughput, sensitive, and reproducible solution that is cGMP-compliant.

A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity