Uncategorized

PrimePCR ddPCR Mutation Assay Validation Data

Gene Name BRAF Gene Symbol BRAF COSMIC ID COSM476 Amino Acid p.V600E Nucleotide c.1799T>A Species Human Gene Aliases BRAF1 RefSeq Accession No. NM_004333.4 UniGeneID Hs.550061 Ensemble Gene Id ENSG00000157764 Entrez Gene ID 673 Unique Assay ID dHsaCP2000028 MiQE Context Sequence CCAGACAACTGTTCAAACTGATGGGACCCACTCCATCGAGATTTC ACTGTAGCTAGACCAAAATCACCTATTTTTACTGTGAGGTCTTCAT GAAGAAATATATCTGAGGTGTAGTAAGTAAAG Amplicon Length 91nt Chromosome Location chr7: 140453091-140453213 Probe Fluorophore HEX Assay Design Mutation Assay Probe Purification HPLC Primer Purification Desalted Instrument QX100 ddPCR System Supermix QX100 Droplet PCR SuperMix
READ MORE →