ArticlesGeneral Interest

Bio-Rad Expert Care — New Service Plans from Bio-Rad’s Service Team

A high quality lab instrument represents a major investment for any researcher. With its new Expert Care service program, Bio-Rad now offers a slate of service plans so its customers can rest assured that their valuable equipment will receive prompt, high-quality support and service at the right level for their needs. Learn about the different options available under the Expert Care service program.
READ MORE →
Real-time qPCR/PCR

PrimePCR ddPCR CNV Assay Validation Data

Gene Name BRCA1 Gene Symbol BRCA1 Species Human Summary breast cancer 1, early onset [Source:HGNC Symbol;Acc:1100] Gene Aliases BRCC1:PPP1R53:RNF53 RefSeq Accession No. NM_007294.3:NM_007299.3:NM_007297.3:NM_007300.3 UniGeneID Hs.194143 Ensemble Gene ID ENSG00000012048 Entrez Gene ID 672 Unique Assay ID dHsaCP1000008 MiQE Context Sequence GTGAAATAAAAGGTAGTATGAGTTCCATCAAGGTGCTTACAGTCTA ATTTAAGGAGACAATGAACCACAAACAATTGTGCCATTAATTCAAA GAGATGATGTCAGCAAACCTAAGAATGTGGG Amplicon Length 82nt Chromosome Location chr17: 41242773-41242895 Probe Fluorophore FAM Assay Design CNV Assay Probe Purification HPLC Primer Purification Desalted Instrument QX200 ddPCR System Supermix QX200 ddPCR Supermix for Probes Assay Specificity > 90% specificity
READ MORE →
ArticlesProtein Interaction AnalysisProtocols and Tips

Guide to SPR Data Analysis on the ProteOn™ XPR36 System

Analyzing protein interaction data using a surface plasmon resonance (SPR) system can be complicated. This user guide describes how to analyze SPR data to obtain kinetic and equilibrium constants, as well as sample concentrations.
READ MORE →
ArticlesProduct HighlightsReal-time qPCR/PCR

New PrimePCR™ Probe Assays for Real-time PCR and Droplet Digital™ PCR Technologies

Bio-Rad’s PrimePCR probe assays gave researchers a powerful, reliable set of investigative tools utilizing SYBR® Green detection chemistry. Now Bio-Rad is adding a number of new assays to the PrimePCR portfolio, bringing the benefits of PrimePCR assays to many new applications for both real-time PCR and Droplet Digital™ PCR platforms.
READ MORE →
ArticlesChromatographyCustomer Stories

The Chromatography Chronicles Part 1: The Votes Are in — Customer Voices and the NGC Chromatography System Design Process

Whether through unreliability, lack of workflows, or poor design, chromatography systems can cause major hassles for any lab involved in purifying proteins. Would Bio-Rad be able to solve these longstanding problems? This new series takes an inside look at the development of the NGC medium-pressure chromatography system. This month: bringing customers into the design process.
READ MORE →
ArticlesProtein Interaction AnalysisProtocols and Tips

Options for Dataset Export Using the ProteOn Manager™ Software

This appendix to “Guide to SPR Data Analysis on the Proteon™ XPR36 System” gives information on the data set export using ProteOn Manager™ Software.
READ MORE →
ArticlesElectrophoresis/Western BlottingFeatured Stories

Revealing BRCA2 Pathways in Cancer with Bio-Rad’s V3 Western Workflow

Twenty years after the discovery of the link between BRCA gene mutations and breast cancer, researcher Ryan Jensen of the Yale Medical School is looking into the interactions between the DNA repair protein RAD51 and BRCA proteins using Bio-Rad’s V3 Western Workflow.
READ MORE →
ArticlesElectrophoresis/Western BlottingTechnical Reports

Reliable, Streamlined 2-D Western Blot Workflow for Evaluation of Antibodies Developed for Detection of Host Cell Proteins

Removing host cell protein (HCP) contaminants represents an essential step in the production of biologics (therapeutic protein drugs), but has long been a time- and labor-intensive process. Here, we demonstrate a simpler, quicker, and more standardized workflow for evaluating anti-HCP antibodies using 2-D electrophoresis and western blotting.
READ MORE →
ArticlesGeneral Interest

Bio-Rad’s Applications & Technologies Pages: A Valuable Resource for Scientists

Discover the wide range of applications for Bio-Rad products in diverse fields of study and learn more about our cutting-edge technologies and their underlying principles. Get protocols, troubleshooting tips, and updates on the latest developments in methods, instrumentation, and software.
READ MORE →
ArticlesElectrophoresis/Western BlottingProtocols and Tips

Using Bio-Rad’s PDQuest Software to Generate a Match Rate between 2-D Electrophoresis and Western Blotting

2-D electrophoresis followed by immunodetection of protein spots using western blotting is adopted commonly in proteomics studies. Here we present step-by-step instructions for obtaining accurate overlaps between the gel and the blot using the PDQuest 2-D gel analysis software.
READ MORE →